ID: 1169528385

View in Genome Browser
Species Human (GRCh38)
Location 20:6455473-6455495
Sequence ACAGCTAGAGTCGGTAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169528385_1169528389 7 Left 1169528385 20:6455473-6455495 CCACTCTTACCGACTCTAGCTGT No data
Right 1169528389 20:6455503-6455525 CCCATTGATTAAACTTTACTGGG No data
1169528385_1169528387 6 Left 1169528385 20:6455473-6455495 CCACTCTTACCGACTCTAGCTGT No data
Right 1169528387 20:6455502-6455524 TCCCATTGATTAAACTTTACTGG No data
1169528385_1169528391 8 Left 1169528385 20:6455473-6455495 CCACTCTTACCGACTCTAGCTGT No data
Right 1169528391 20:6455504-6455526 CCATTGATTAAACTTTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169528385 Original CRISPR ACAGCTAGAGTCGGTAAGAG TGG (reversed) Intergenic