ID: 1169528391

View in Genome Browser
Species Human (GRCh38)
Location 20:6455504-6455526
Sequence CCATTGATTAAACTTTACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169528385_1169528391 8 Left 1169528385 20:6455473-6455495 CCACTCTTACCGACTCTAGCTGT No data
Right 1169528391 20:6455504-6455526 CCATTGATTAAACTTTACTGGGG No data
1169528386_1169528391 -1 Left 1169528386 20:6455482-6455504 CCGACTCTAGCTGTGAATGCTCC No data
Right 1169528391 20:6455504-6455526 CCATTGATTAAACTTTACTGGGG No data
1169528384_1169528391 30 Left 1169528384 20:6455451-6455473 CCTGAGTAGTAGGTAATACACAC No data
Right 1169528391 20:6455504-6455526 CCATTGATTAAACTTTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169528391 Original CRISPR CCATTGATTAAACTTTACTG GGG Intergenic