ID: 1169529890

View in Genome Browser
Species Human (GRCh38)
Location 20:6473782-6473804
Sequence CCAAATGCACATTCCCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169529886_1169529890 11 Left 1169529886 20:6473748-6473770 CCTCTGCTAAGGCTCTGCAAATC No data
Right 1169529890 20:6473782-6473804 CCAAATGCACATTCCCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169529890 Original CRISPR CCAAATGCACATTCCCTGCA TGG Intergenic
No off target data available for this crispr