ID: 1169530606

View in Genome Browser
Species Human (GRCh38)
Location 20:6481206-6481228
Sequence CTCAGGCTAAATCCAAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169530606_1169530608 -10 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530608 20:6481219-6481241 TTAGCCTGAGCAGCCATCATGGG No data
1169530606_1169530616 21 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530616 20:6481250-6481272 TGGGGAGGTTCCACAAGATGAGG No data
1169530606_1169530609 -7 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530609 20:6481222-6481244 GCCTGAGCAGCCATCATGGGAGG No data
1169530606_1169530617 25 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530617 20:6481254-6481276 GAGGTTCCACAAGATGAGGAAGG No data
1169530606_1169530615 6 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530615 20:6481235-6481257 TCATGGGAGGCTGTCTGGGGAGG No data
1169530606_1169530612 2 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530612 20:6481231-6481253 GCCATCATGGGAGGCTGTCTGGG No data
1169530606_1169530611 1 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530611 20:6481230-6481252 AGCCATCATGGGAGGCTGTCTGG No data
1169530606_1169530614 3 Left 1169530606 20:6481206-6481228 CCAAGGCTTGGATTTAGCCTGAG No data
Right 1169530614 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169530606 Original CRISPR CTCAGGCTAAATCCAAGCCT TGG (reversed) Intergenic
No off target data available for this crispr