ID: 1169530610

View in Genome Browser
Species Human (GRCh38)
Location 20:6481223-6481245
Sequence GCCTCCCATGATGGCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169530610_1169530619 26 Left 1169530610 20:6481223-6481245 CCTGAGCAGCCATCATGGGAGGC No data
Right 1169530619 20:6481272-6481294 GAAGGAAGTCAGTGAGAATCAGG No data
1169530610_1169530617 8 Left 1169530610 20:6481223-6481245 CCTGAGCAGCCATCATGGGAGGC No data
Right 1169530617 20:6481254-6481276 GAGGTTCCACAAGATGAGGAAGG No data
1169530610_1169530616 4 Left 1169530610 20:6481223-6481245 CCTGAGCAGCCATCATGGGAGGC No data
Right 1169530616 20:6481250-6481272 TGGGGAGGTTCCACAAGATGAGG No data
1169530610_1169530620 27 Left 1169530610 20:6481223-6481245 CCTGAGCAGCCATCATGGGAGGC No data
Right 1169530620 20:6481273-6481295 AAGGAAGTCAGTGAGAATCAGGG No data
1169530610_1169530621 28 Left 1169530610 20:6481223-6481245 CCTGAGCAGCCATCATGGGAGGC No data
Right 1169530621 20:6481274-6481296 AGGAAGTCAGTGAGAATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169530610 Original CRISPR GCCTCCCATGATGGCTGCTC AGG (reversed) Intergenic
No off target data available for this crispr