ID: 1169530613

View in Genome Browser
Species Human (GRCh38)
Location 20:6481232-6481254
Sequence CCCCAGACAGCCTCCCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169530613_1169530616 -5 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530616 20:6481250-6481272 TGGGGAGGTTCCACAAGATGAGG No data
1169530613_1169530621 19 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530621 20:6481274-6481296 AGGAAGTCAGTGAGAATCAGGGG No data
1169530613_1169530617 -1 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530617 20:6481254-6481276 GAGGTTCCACAAGATGAGGAAGG No data
1169530613_1169530619 17 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530619 20:6481272-6481294 GAAGGAAGTCAGTGAGAATCAGG No data
1169530613_1169530622 26 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530622 20:6481281-6481303 CAGTGAGAATCAGGGGCAACTGG No data
1169530613_1169530620 18 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530620 20:6481273-6481295 AAGGAAGTCAGTGAGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169530613 Original CRISPR CCCCAGACAGCCTCCCATGA TGG (reversed) Intergenic
No off target data available for this crispr