ID: 1169530620

View in Genome Browser
Species Human (GRCh38)
Location 20:6481273-6481295
Sequence AAGGAAGTCAGTGAGAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169530613_1169530620 18 Left 1169530613 20:6481232-6481254 CCATCATGGGAGGCTGTCTGGGG No data
Right 1169530620 20:6481273-6481295 AAGGAAGTCAGTGAGAATCAGGG No data
1169530610_1169530620 27 Left 1169530610 20:6481223-6481245 CCTGAGCAGCCATCATGGGAGGC No data
Right 1169530620 20:6481273-6481295 AAGGAAGTCAGTGAGAATCAGGG No data
1169530618_1169530620 -10 Left 1169530618 20:6481260-6481282 CCACAAGATGAGGAAGGAAGTCA No data
Right 1169530620 20:6481273-6481295 AAGGAAGTCAGTGAGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169530620 Original CRISPR AAGGAAGTCAGTGAGAATCA GGG Intergenic
No off target data available for this crispr