ID: 1169540016

View in Genome Browser
Species Human (GRCh38)
Location 20:6589783-6589805
Sequence TTTGTGGGCGAGTATCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169540016_1169540026 17 Left 1169540016 20:6589783-6589805 CCCCCTGGATACTCGCCCACAAA No data
Right 1169540026 20:6589823-6589845 CTAGACTGGGTTTTAACTTCTGG No data
1169540016_1169540024 3 Left 1169540016 20:6589783-6589805 CCCCCTGGATACTCGCCCACAAA No data
Right 1169540024 20:6589809-6589831 GAGTAGAGGAAGGACTAGACTGG No data
1169540016_1169540025 4 Left 1169540016 20:6589783-6589805 CCCCCTGGATACTCGCCCACAAA No data
Right 1169540025 20:6589810-6589832 AGTAGAGGAAGGACTAGACTGGG No data
1169540016_1169540023 -7 Left 1169540016 20:6589783-6589805 CCCCCTGGATACTCGCCCACAAA No data
Right 1169540023 20:6589799-6589821 CCACAAAAAAGAGTAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169540016 Original CRISPR TTTGTGGGCGAGTATCCAGG GGG (reversed) Intergenic
No off target data available for this crispr