ID: 1169540460

View in Genome Browser
Species Human (GRCh38)
Location 20:6593971-6593993
Sequence CTCCTCAAGGGATTGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169540453_1169540460 14 Left 1169540453 20:6593934-6593956 CCATGATGGTGGGTGAAGAGGGG No data
Right 1169540460 20:6593971-6593993 CTCCTCAAGGGATTGATGCTTGG No data
1169540451_1169540460 15 Left 1169540451 20:6593933-6593955 CCCATGATGGTGGGTGAAGAGGG No data
Right 1169540460 20:6593971-6593993 CTCCTCAAGGGATTGATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169540460 Original CRISPR CTCCTCAAGGGATTGATGCT TGG Intergenic