ID: 1169544506

View in Genome Browser
Species Human (GRCh38)
Location 20:6636897-6636919
Sequence GTGTGTACACATATTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169544502_1169544506 7 Left 1169544502 20:6636867-6636889 CCAACCTCCTGAAGCTGTGAAAA No data
Right 1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG No data
1169544503_1169544506 3 Left 1169544503 20:6636871-6636893 CCTCCTGAAGCTGTGAAAAAAAC No data
Right 1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG No data
1169544504_1169544506 0 Left 1169544504 20:6636874-6636896 CCTGAAGCTGTGAAAAAAACTTT No data
Right 1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG No data
1169544501_1169544506 28 Left 1169544501 20:6636846-6636868 CCAATCAATGGTATTTGTAGTCC No data
Right 1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG No data
1169544500_1169544506 29 Left 1169544500 20:6636845-6636867 CCCAATCAATGGTATTTGTAGTC No data
Right 1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169544506 Original CRISPR GTGTGTACACATATTTTTCT GGG Intergenic
No off target data available for this crispr