ID: 1169553553

View in Genome Browser
Species Human (GRCh38)
Location 20:6726343-6726365
Sequence GTGTGGATTCTCAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169553547_1169553553 1 Left 1169553547 20:6726319-6726341 CCAATAGAGTAGGGCAGGGTCCT No data
Right 1169553553 20:6726343-6726365 GTGTGGATTCTCAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169553553 Original CRISPR GTGTGGATTCTCAGGGAAGA TGG Intergenic
No off target data available for this crispr