ID: 1169557606

View in Genome Browser
Species Human (GRCh38)
Location 20:6767620-6767642
Sequence GGCCGCGGCCGGGAGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4765
Summary {0: 1, 1: 0, 2: 13, 3: 120, 4: 4631}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169557593_1169557606 10 Left 1169557593 20:6767587-6767609 CCGGCGAGCCGCGCCGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 72
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557600_1169557606 -3 Left 1169557600 20:6767600-6767622 CCGCGAAGGGGGAGGTGTTCGGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557587_1169557606 28 Left 1169557587 20:6767569-6767591 CCGCCCGCTCGGGGATCCCCGGC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557591_1169557606 11 Left 1169557591 20:6767586-6767608 CCCGGCGAGCCGCGCCGCGAAGG 0: 1
1: 0
2: 1
3: 8
4: 85
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557598_1169557606 2 Left 1169557598 20:6767595-6767617 CCGCGCCGCGAAGGGGGAGGTGT 0: 1
1: 0
2: 1
3: 2
4: 57
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557589_1169557606 24 Left 1169557589 20:6767573-6767595 CCGCTCGGGGATCCCCGGCGAGC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557585_1169557606 29 Left 1169557585 20:6767568-6767590 CCCGCCCGCTCGGGGATCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557588_1169557606 25 Left 1169557588 20:6767572-6767594 CCCGCTCGGGGATCCCCGGCGAG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631
1169557590_1169557606 12 Left 1169557590 20:6767585-6767607 CCCCGGCGAGCCGCGCCGCGAAG 0: 1
1: 0
2: 2
3: 10
4: 89
Right 1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG 0: 1
1: 0
2: 13
3: 120
4: 4631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169557606 Original CRISPR GGCCGCGGCCGGGAGGGAGC CGG Intergenic
Too many off-targets to display for this crispr