ID: 1169560915

View in Genome Browser
Species Human (GRCh38)
Location 20:6799861-6799883
Sequence GGTGTCATCATTCCAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169560910_1169560915 14 Left 1169560910 20:6799824-6799846 CCAGCAGAGGGTGGTTGGCAGAG No data
Right 1169560915 20:6799861-6799883 GGTGTCATCATTCCAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169560915 Original CRISPR GGTGTCATCATTCCAATGGA AGG Intergenic
No off target data available for this crispr