ID: 1169563205

View in Genome Browser
Species Human (GRCh38)
Location 20:6824401-6824423
Sequence TAGACAACCCATTTTGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169563201_1169563205 2 Left 1169563201 20:6824376-6824398 CCAGAAACTCAGCGGGTGGAAGG No data
Right 1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG No data
1169563200_1169563205 3 Left 1169563200 20:6824375-6824397 CCCAGAAACTCAGCGGGTGGAAG No data
Right 1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG No data
1169563198_1169563205 6 Left 1169563198 20:6824372-6824394 CCACCCAGAAACTCAGCGGGTGG No data
Right 1169563205 20:6824401-6824423 TAGACAACCCATTTTGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169563205 Original CRISPR TAGACAACCCATTTTGGTTC TGG Intergenic
No off target data available for this crispr