ID: 1169563255

View in Genome Browser
Species Human (GRCh38)
Location 20:6825054-6825076
Sequence TAACCCTCGATTACTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169563252_1169563255 25 Left 1169563252 20:6825006-6825028 CCAGGATGCTTTTTAGTGATCAG No data
Right 1169563255 20:6825054-6825076 TAACCCTCGATTACTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169563255 Original CRISPR TAACCCTCGATTACTGTGGG AGG Intergenic
No off target data available for this crispr