ID: 1169564042

View in Genome Browser
Species Human (GRCh38)
Location 20:6833354-6833376
Sequence CAGAGTAAAAAGAACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169564037_1169564042 23 Left 1169564037 20:6833308-6833330 CCCAGATCACAGAATCACTGGGA No data
Right 1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG No data
1169564038_1169564042 22 Left 1169564038 20:6833309-6833331 CCAGATCACAGAATCACTGGGAG No data
Right 1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169564042 Original CRISPR CAGAGTAAAAAGAACCATGA AGG Intergenic
No off target data available for this crispr