ID: 1169564762

View in Genome Browser
Species Human (GRCh38)
Location 20:6841752-6841774
Sequence TTCTTTCTGATCCAAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169564759_1169564762 -7 Left 1169564759 20:6841736-6841758 CCTGCTATGCTGGCCCTTCTTTC No data
Right 1169564762 20:6841752-6841774 TTCTTTCTGATCCAAGAGTCAGG No data
1169564758_1169564762 -6 Left 1169564758 20:6841735-6841757 CCCTGCTATGCTGGCCCTTCTTT No data
Right 1169564762 20:6841752-6841774 TTCTTTCTGATCCAAGAGTCAGG No data
1169564756_1169564762 7 Left 1169564756 20:6841722-6841744 CCTAGTAGACATGCCCTGCTATG No data
Right 1169564762 20:6841752-6841774 TTCTTTCTGATCCAAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169564762 Original CRISPR TTCTTTCTGATCCAAGAGTC AGG Intergenic
No off target data available for this crispr