ID: 1169580297

View in Genome Browser
Species Human (GRCh38)
Location 20:7015284-7015306
Sequence ATGGATACACAGATCACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169580297_1169580300 1 Left 1169580297 20:7015284-7015306 CCATTTGTGATCTGTGTATCCAT No data
Right 1169580300 20:7015308-7015330 ATTGTTTGAAAAAGGAGCCCAGG No data
1169580297_1169580298 -7 Left 1169580297 20:7015284-7015306 CCATTTGTGATCTGTGTATCCAT No data
Right 1169580298 20:7015300-7015322 TATCCATGATTGTTTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169580297 Original CRISPR ATGGATACACAGATCACAAA TGG (reversed) Intergenic
No off target data available for this crispr