ID: 1169584695

View in Genome Browser
Species Human (GRCh38)
Location 20:7068071-7068093
Sequence TTTGAGAGATGTAAAGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169584695_1169584700 25 Left 1169584695 20:7068071-7068093 CCCTTTACTTTACATCTCTCAAA No data
Right 1169584700 20:7068119-7068141 CACCTCACAATGCTGTATTTAGG No data
1169584695_1169584703 27 Left 1169584695 20:7068071-7068093 CCCTTTACTTTACATCTCTCAAA No data
Right 1169584703 20:7068121-7068143 CCTCACAATGCTGTATTTAGGGG No data
1169584695_1169584701 26 Left 1169584695 20:7068071-7068093 CCCTTTACTTTACATCTCTCAAA No data
Right 1169584701 20:7068120-7068142 ACCTCACAATGCTGTATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169584695 Original CRISPR TTTGAGAGATGTAAAGTAAA GGG (reversed) Intergenic
No off target data available for this crispr