ID: 1169584700

View in Genome Browser
Species Human (GRCh38)
Location 20:7068119-7068141
Sequence CACCTCACAATGCTGTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169584695_1169584700 25 Left 1169584695 20:7068071-7068093 CCCTTTACTTTACATCTCTCAAA No data
Right 1169584700 20:7068119-7068141 CACCTCACAATGCTGTATTTAGG No data
1169584696_1169584700 24 Left 1169584696 20:7068072-7068094 CCTTTACTTTACATCTCTCAAAC No data
Right 1169584700 20:7068119-7068141 CACCTCACAATGCTGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169584700 Original CRISPR CACCTCACAATGCTGTATTT AGG Intergenic
No off target data available for this crispr