ID: 1169596707

View in Genome Browser
Species Human (GRCh38)
Location 20:7208327-7208349
Sequence AGTTGTAAACACATGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169596707_1169596710 22 Left 1169596707 20:7208327-7208349 CCAAACTTCATGTGTTTACAACT No data
Right 1169596710 20:7208372-7208394 TAAGAAGTGGGTCATTTAAGAGG No data
1169596707_1169596708 9 Left 1169596707 20:7208327-7208349 CCAAACTTCATGTGTTTACAACT No data
Right 1169596708 20:7208359-7208381 GTTATAACAATATTAAGAAGTGG No data
1169596707_1169596709 10 Left 1169596707 20:7208327-7208349 CCAAACTTCATGTGTTTACAACT No data
Right 1169596709 20:7208360-7208382 TTATAACAATATTAAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169596707 Original CRISPR AGTTGTAAACACATGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr