ID: 1169603455

View in Genome Browser
Species Human (GRCh38)
Location 20:7289099-7289121
Sequence AGTCACCATCTTCCAAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169603453_1169603455 1 Left 1169603453 20:7289075-7289097 CCAGGCATGCACAACTGTGCCTT No data
Right 1169603455 20:7289099-7289121 AGTCACCATCTTCCAAGCATTGG No data
1169603452_1169603455 13 Left 1169603452 20:7289063-7289085 CCAGAGATTGTGCCAGGCATGCA No data
Right 1169603455 20:7289099-7289121 AGTCACCATCTTCCAAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169603455 Original CRISPR AGTCACCATCTTCCAAGCAT TGG Intergenic
No off target data available for this crispr