ID: 1169603482

View in Genome Browser
Species Human (GRCh38)
Location 20:7289386-7289408
Sequence CAAAAAAGCATGCATCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169603482_1169603484 27 Left 1169603482 20:7289386-7289408 CCCTGGGGATGCATGCTTTTTTG No data
Right 1169603484 20:7289436-7289458 TTCACTCCTTGAAAACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169603482 Original CRISPR CAAAAAAGCATGCATCCCCA GGG (reversed) Intergenic
No off target data available for this crispr