ID: 1169611855

View in Genome Browser
Species Human (GRCh38)
Location 20:7389941-7389963
Sequence CATGCTGGAATCTGTGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169611855_1169611859 1 Left 1169611855 20:7389941-7389963 CCTAGATCACAGATTCCAGCATG No data
Right 1169611859 20:7389965-7389987 AAAGACATCTGGAAACTGATGGG No data
1169611855_1169611860 17 Left 1169611855 20:7389941-7389963 CCTAGATCACAGATTCCAGCATG No data
Right 1169611860 20:7389981-7390003 TGATGGGACACACTCTGAAGAGG No data
1169611855_1169611858 0 Left 1169611855 20:7389941-7389963 CCTAGATCACAGATTCCAGCATG No data
Right 1169611858 20:7389964-7389986 AAAAGACATCTGGAAACTGATGG No data
1169611855_1169611856 -10 Left 1169611855 20:7389941-7389963 CCTAGATCACAGATTCCAGCATG No data
Right 1169611856 20:7389954-7389976 TTCCAGCATGAAAAGACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169611855 Original CRISPR CATGCTGGAATCTGTGATCT AGG (reversed) Intergenic
No off target data available for this crispr