ID: 1169619230

View in Genome Browser
Species Human (GRCh38)
Location 20:7486538-7486560
Sequence GAGGTACACCTGACTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169619230_1169619231 -9 Left 1169619230 20:7486538-7486560 CCTCTTAGAGTCAGGTGTACCTC No data
Right 1169619231 20:7486552-7486574 GTGTACCTCCCCACCAAGTATGG No data
1169619230_1169619237 23 Left 1169619230 20:7486538-7486560 CCTCTTAGAGTCAGGTGTACCTC No data
Right 1169619237 20:7486584-7486606 GAAATCTTGAGTTCCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169619230 Original CRISPR GAGGTACACCTGACTCTAAG AGG (reversed) Intergenic
No off target data available for this crispr