ID: 1169623675

View in Genome Browser
Species Human (GRCh38)
Location 20:7538722-7538744
Sequence CCCTGCCCAAAGCTAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169623671_1169623675 11 Left 1169623671 20:7538688-7538710 CCAGACTAGTGAAAAGAAGTGCA No data
Right 1169623675 20:7538722-7538744 CCCTGCCCAAAGCTAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169623675 Original CRISPR CCCTGCCCAAAGCTAGTGTC TGG Intergenic
No off target data available for this crispr