ID: 1169623815

View in Genome Browser
Species Human (GRCh38)
Location 20:7540154-7540176
Sequence TCCCTATGATGTTCCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169623815_1169623819 0 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623819 20:7540177-7540199 GAGAGAATCTGTGTGCCTGGGGG No data
1169623815_1169623824 23 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG No data
1169623815_1169623816 -3 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623816 20:7540174-7540196 GGAGAGAGAATCTGTGTGCCTGG No data
1169623815_1169623822 13 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623815_1169623820 3 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623820 20:7540180-7540202 AGAATCTGTGTGCCTGGGGGAGG No data
1169623815_1169623817 -2 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623817 20:7540175-7540197 GAGAGAGAATCTGTGTGCCTGGG No data
1169623815_1169623818 -1 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623818 20:7540176-7540198 AGAGAGAATCTGTGTGCCTGGGG No data
1169623815_1169623821 4 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169623815 Original CRISPR TCCCTATGATGTTCCACTGC TGG (reversed) Intergenic
No off target data available for this crispr