ID: 1169623821

View in Genome Browser
Species Human (GRCh38)
Location 20:7540181-7540203
Sequence GAATCTGTGTGCCTGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169623811_1169623821 8 Left 1169623811 20:7540150-7540172 CCCACCAGCAGTGGAACATCATA No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623804_1169623821 18 Left 1169623804 20:7540140-7540162 CCCTCCCCCACCCACCAGCAGTG No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623812_1169623821 7 Left 1169623812 20:7540151-7540173 CCACCAGCAGTGGAACATCATAG No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623809_1169623821 12 Left 1169623809 20:7540146-7540168 CCCACCCACCAGCAGTGGAACAT No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623805_1169623821 17 Left 1169623805 20:7540141-7540163 CCTCCCCCACCCACCAGCAGTGG No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623815_1169623821 4 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623807_1169623821 14 Left 1169623807 20:7540144-7540166 CCCCCACCCACCAGCAGTGGAAC No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623808_1169623821 13 Left 1169623808 20:7540145-7540167 CCCCACCCACCAGCAGTGGAACA No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623803_1169623821 22 Left 1169623803 20:7540136-7540158 CCAGCCCTCCCCCACCCACCAGC No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623810_1169623821 11 Left 1169623810 20:7540147-7540169 CCACCCACCAGCAGTGGAACATC No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data
1169623802_1169623821 28 Left 1169623802 20:7540130-7540152 CCTATACCAGCCCTCCCCCACCC No data
Right 1169623821 20:7540181-7540203 GAATCTGTGTGCCTGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169623821 Original CRISPR GAATCTGTGTGCCTGGGGGA GGG Intergenic
No off target data available for this crispr