ID: 1169623822

View in Genome Browser
Species Human (GRCh38)
Location 20:7540190-7540212
Sequence TGCCTGGGGGAGGGAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169623809_1169623822 21 Left 1169623809 20:7540146-7540168 CCCACCCACCAGCAGTGGAACAT No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623804_1169623822 27 Left 1169623804 20:7540140-7540162 CCCTCCCCCACCCACCAGCAGTG No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623807_1169623822 23 Left 1169623807 20:7540144-7540166 CCCCCACCCACCAGCAGTGGAAC No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623812_1169623822 16 Left 1169623812 20:7540151-7540173 CCACCAGCAGTGGAACATCATAG No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623815_1169623822 13 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623805_1169623822 26 Left 1169623805 20:7540141-7540163 CCTCCCCCACCCACCAGCAGTGG No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623810_1169623822 20 Left 1169623810 20:7540147-7540169 CCACCCACCAGCAGTGGAACATC No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623811_1169623822 17 Left 1169623811 20:7540150-7540172 CCCACCAGCAGTGGAACATCATA No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data
1169623808_1169623822 22 Left 1169623808 20:7540145-7540167 CCCCACCCACCAGCAGTGGAACA No data
Right 1169623822 20:7540190-7540212 TGCCTGGGGGAGGGAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169623822 Original CRISPR TGCCTGGGGGAGGGAGAGCA AGG Intergenic
No off target data available for this crispr