ID: 1169623824

View in Genome Browser
Species Human (GRCh38)
Location 20:7540200-7540222
Sequence AGGGAGAGCAAGGTGATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169623812_1169623824 26 Left 1169623812 20:7540151-7540173 CCACCAGCAGTGGAACATCATAG No data
Right 1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG No data
1169623815_1169623824 23 Left 1169623815 20:7540154-7540176 CCAGCAGTGGAACATCATAGGGA No data
Right 1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG No data
1169623810_1169623824 30 Left 1169623810 20:7540147-7540169 CCACCCACCAGCAGTGGAACATC No data
Right 1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG No data
1169623811_1169623824 27 Left 1169623811 20:7540150-7540172 CCCACCAGCAGTGGAACATCATA No data
Right 1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169623824 Original CRISPR AGGGAGAGCAAGGTGATTGT AGG Intergenic
No off target data available for this crispr