ID: 1169624661

View in Genome Browser
Species Human (GRCh38)
Location 20:7551069-7551091
Sequence ACCAAAGATGTGCCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169624660_1169624661 -3 Left 1169624660 20:7551049-7551071 CCAGAGGCATTGTTTTGGTTACC No data
Right 1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG No data
1169624656_1169624661 14 Left 1169624656 20:7551032-7551054 CCATTTTGGAGGAGATCCCAGAG No data
Right 1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG No data
1169624659_1169624661 -2 Left 1169624659 20:7551048-7551070 CCCAGAGGCATTGTTTTGGTTAC No data
Right 1169624661 20:7551069-7551091 ACCAAAGATGTGCCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169624661 Original CRISPR ACCAAAGATGTGCCTCCTTC AGG Intergenic
No off target data available for this crispr