ID: 1169627104

View in Genome Browser
Species Human (GRCh38)
Location 20:7583196-7583218
Sequence AATCTGGATGAGGCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169627099_1169627104 2 Left 1169627099 20:7583171-7583193 CCTGTAAAACCATTCTAGGTACC No data
Right 1169627104 20:7583196-7583218 AATCTGGATGAGGCTTTTCCAGG No data
1169627097_1169627104 16 Left 1169627097 20:7583157-7583179 CCTAAAATTCTGTTCCTGTAAAA No data
Right 1169627104 20:7583196-7583218 AATCTGGATGAGGCTTTTCCAGG No data
1169627100_1169627104 -7 Left 1169627100 20:7583180-7583202 CCATTCTAGGTACCAAAATCTGG No data
Right 1169627104 20:7583196-7583218 AATCTGGATGAGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169627104 Original CRISPR AATCTGGATGAGGCTTTTCC AGG Intergenic