ID: 1169630575

View in Genome Browser
Species Human (GRCh38)
Location 20:7626142-7626164
Sequence TGCACCGGTGAAGGGTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169630575_1169630585 4 Left 1169630575 20:7626142-7626164 CCACCTGACCCTTCACCGGTGCA No data
Right 1169630585 20:7626169-7626191 CCCATGGAGCAAAAGGGAACAGG No data
1169630575_1169630589 30 Left 1169630575 20:7626142-7626164 CCACCTGACCCTTCACCGGTGCA No data
Right 1169630589 20:7626195-7626217 GTCAGTGCTTTCTCTTTTTTTGG No data
1169630575_1169630588 6 Left 1169630575 20:7626142-7626164 CCACCTGACCCTTCACCGGTGCA No data
Right 1169630588 20:7626171-7626193 CATGGAGCAAAAGGGAACAGGGG No data
1169630575_1169630581 -3 Left 1169630575 20:7626142-7626164 CCACCTGACCCTTCACCGGTGCA No data
Right 1169630581 20:7626162-7626184 GCACTGCCCCATGGAGCAAAAGG No data
1169630575_1169630582 -2 Left 1169630575 20:7626142-7626164 CCACCTGACCCTTCACCGGTGCA No data
Right 1169630582 20:7626163-7626185 CACTGCCCCATGGAGCAAAAGGG No data
1169630575_1169630587 5 Left 1169630575 20:7626142-7626164 CCACCTGACCCTTCACCGGTGCA No data
Right 1169630587 20:7626170-7626192 CCATGGAGCAAAAGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169630575 Original CRISPR TGCACCGGTGAAGGGTCAGG TGG (reversed) Intergenic
No off target data available for this crispr