ID: 1169630874

View in Genome Browser
Species Human (GRCh38)
Location 20:7629856-7629878
Sequence CTAATATTTCACAATTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169630870_1169630874 5 Left 1169630870 20:7629828-7629850 CCCAAACTGCAATTACTTTTGCA 0: 50
1: 95
2: 168
3: 147
4: 369
Right 1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG No data
1169630871_1169630874 4 Left 1169630871 20:7629829-7629851 CCAAACTGCAATTACTTTTGCAC No data
Right 1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG No data
1169630868_1169630874 7 Left 1169630868 20:7629826-7629848 CCCCCAAACTGCAATTACTTTTG No data
Right 1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG No data
1169630867_1169630874 20 Left 1169630867 20:7629813-7629835 CCAGCAAAGTAATCCCCCAAACT No data
Right 1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG No data
1169630869_1169630874 6 Left 1169630869 20:7629827-7629849 CCCCAAACTGCAATTACTTTTGC No data
Right 1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169630874 Original CRISPR CTAATATTTCACAATTATAT AGG Intergenic
No off target data available for this crispr