ID: 1169633199

View in Genome Browser
Species Human (GRCh38)
Location 20:7656994-7657016
Sequence CATTCTAGGGAGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169633188_1169633199 30 Left 1169633188 20:7656941-7656963 CCTAGTAATGCAAACGATAGCTG No data
Right 1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG No data
1169633189_1169633199 7 Left 1169633189 20:7656964-7656986 CCACTTTTGACTAAAGTGTAGAA No data
Right 1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169633199 Original CRISPR CATTCTAGGGAGAGGGGGGA GGG Intergenic
No off target data available for this crispr