ID: 1169633199 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:7656994-7657016 |
Sequence | CATTCTAGGGAGAGGGGGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1169633188_1169633199 | 30 | Left | 1169633188 | 20:7656941-7656963 | CCTAGTAATGCAAACGATAGCTG | No data | ||
Right | 1169633199 | 20:7656994-7657016 | CATTCTAGGGAGAGGGGGGAGGG | No data | ||||
1169633189_1169633199 | 7 | Left | 1169633189 | 20:7656964-7656986 | CCACTTTTGACTAAAGTGTAGAA | No data | ||
Right | 1169633199 | 20:7656994-7657016 | CATTCTAGGGAGAGGGGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1169633199 | Original CRISPR | CATTCTAGGGAGAGGGGGGA GGG | Intergenic | ||
No off target data available for this crispr |