ID: 1169641432

View in Genome Browser
Species Human (GRCh38)
Location 20:7756808-7756830
Sequence TCCTCCCCAGAATAGATCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169641432_1169641434 16 Left 1169641432 20:7756808-7756830 CCTAAGATCTATTCTGGGGAGGA No data
Right 1169641434 20:7756847-7756869 AAAAGACCATAAGGAAATATCGG No data
1169641432_1169641433 7 Left 1169641432 20:7756808-7756830 CCTAAGATCTATTCTGGGGAGGA No data
Right 1169641433 20:7756838-7756860 TTGAGAAGTAAAAGACCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169641432 Original CRISPR TCCTCCCCAGAATAGATCTT AGG (reversed) Intergenic
No off target data available for this crispr