ID: 1169645103

View in Genome Browser
Species Human (GRCh38)
Location 20:7801653-7801675
Sequence GTAGGAGACTAGTTTAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169645103_1169645106 15 Left 1169645103 20:7801653-7801675 CCACACCTAAACTAGTCTCCTAC No data
Right 1169645106 20:7801691-7801713 TCCCTAACTTGACCCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169645103 Original CRISPR GTAGGAGACTAGTTTAGGTG TGG (reversed) Intergenic
No off target data available for this crispr