ID: 1169648674

View in Genome Browser
Species Human (GRCh38)
Location 20:7842788-7842810
Sequence TTATGGCCTACTTTCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169648674_1169648683 13 Left 1169648674 20:7842788-7842810 CCTCCCTTGAAAGTAGGCCATAA No data
Right 1169648683 20:7842824-7842846 GAGGGTCCTGCCCCATATCCAGG No data
1169648674_1169648678 -6 Left 1169648674 20:7842788-7842810 CCTCCCTTGAAAGTAGGCCATAA No data
Right 1169648678 20:7842805-7842827 CCATAAGACCCTCATTCCAGAGG No data
1169648674_1169648686 16 Left 1169648674 20:7842788-7842810 CCTCCCTTGAAAGTAGGCCATAA No data
Right 1169648686 20:7842827-7842849 GGTCCTGCCCCATATCCAGGGGG No data
1169648674_1169648679 -5 Left 1169648674 20:7842788-7842810 CCTCCCTTGAAAGTAGGCCATAA No data
Right 1169648679 20:7842806-7842828 CATAAGACCCTCATTCCAGAGGG 0: 21
1: 62
2: 97
3: 132
4: 222
1169648674_1169648684 14 Left 1169648674 20:7842788-7842810 CCTCCCTTGAAAGTAGGCCATAA No data
Right 1169648684 20:7842825-7842847 AGGGTCCTGCCCCATATCCAGGG No data
1169648674_1169648685 15 Left 1169648674 20:7842788-7842810 CCTCCCTTGAAAGTAGGCCATAA No data
Right 1169648685 20:7842826-7842848 GGGTCCTGCCCCATATCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169648674 Original CRISPR TTATGGCCTACTTTCAAGGG AGG (reversed) Intergenic
No off target data available for this crispr