ID: 1169659576

View in Genome Browser
Species Human (GRCh38)
Location 20:7963598-7963620
Sequence CTCCCCTAAATAACTTAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169659570_1169659576 -5 Left 1169659570 20:7963580-7963602 CCACCGGTCCCCTTGCCACTCCC No data
Right 1169659576 20:7963598-7963620 CTCCCCTAAATAACTTAAGACGG No data
1169659571_1169659576 -8 Left 1169659571 20:7963583-7963605 CCGGTCCCCTTGCCACTCCCCTA No data
Right 1169659576 20:7963598-7963620 CTCCCCTAAATAACTTAAGACGG No data
1169659569_1169659576 2 Left 1169659569 20:7963573-7963595 CCATCTTCCACCGGTCCCCTTGC No data
Right 1169659576 20:7963598-7963620 CTCCCCTAAATAACTTAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169659576 Original CRISPR CTCCCCTAAATAACTTAAGA CGG Intergenic
No off target data available for this crispr