ID: 1169661804

View in Genome Browser
Species Human (GRCh38)
Location 20:7986722-7986744
Sequence TCCCCAGGTATTTTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169661804 Original CRISPR TCCCCAGGTATTTTCTCCCC AGG (reversed) Intronic
900974191 1:6007157-6007179 TCCCCAGATAGTTACTGCCCGGG + Intronic
903226494 1:21896782-21896804 TCCCCAGGCAGCTCCTCCCCAGG + Intronic
904682008 1:32235673-32235695 TCCCCAGGTACTTTCTCAAAGGG - Intergenic
905211049 1:36374397-36374419 ACTCCATGTATTTTTTCCCCAGG - Intronic
906169490 1:43712313-43712335 TCCCCACCTTTTTTCTCCCTTGG + Intronic
906511523 1:46412847-46412869 TGCCCATGTACTTTCTCCACTGG - Intronic
906586820 1:46985394-46985416 CCCCCAGGTGCTTTCTCCCAGGG - Intergenic
911226854 1:95316404-95316426 ACCCCAGGGAATTTCTCCCATGG + Intergenic
912321042 1:108713685-108713707 TTACCAGTTATTGTCTCCCCAGG - Intronic
912966291 1:114240106-114240128 TCCCCAGGTGCTGTCTCCCAGGG - Intergenic
913265569 1:117039990-117040012 TTGCCAGGTAATTACTCCCCAGG + Intergenic
915349918 1:155217875-155217897 TCACCATGGAGTTTCTCCCCTGG - Intergenic
915758119 1:158282789-158282811 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
915934454 1:160082595-160082617 TACCCAGGCAGTTTCTCCCCAGG + Intronic
916075090 1:161196065-161196087 TCCCAAGGTATTCTTCCCCCAGG - Intronic
917511763 1:175674724-175674746 TCCCTGGGTAGTTCCTCCCCAGG + Intronic
920160884 1:203996868-203996890 TTCCCAGCTTTTGTCTCCCCCGG - Intergenic
921520043 1:216147217-216147239 TCCCCAGGTTGTTCCTCGCCAGG + Intronic
922370235 1:224902706-224902728 TCCCCAGTTTTTTTCTCTCTTGG + Intronic
923853475 1:237821054-237821076 TCCCCAGGTGCTCTCTCCCAAGG - Intronic
924237859 1:242014190-242014212 TTACTAGATATTTTCTCCCCAGG - Intergenic
924692661 1:246366478-246366500 TGCCCAAGTATTTTCTCTGCAGG - Intronic
1063061250 10:2555758-2555780 TTCCCAGGTCATTTCTCTCCTGG + Intergenic
1063577893 10:7278460-7278482 TCCTCAGGGCTTTGCTCCCCGGG - Intronic
1064091306 10:12387988-12388010 GCCTCAGCTCTTTTCTCCCCTGG + Intronic
1067896880 10:50191848-50191870 TCCCCAGGTGTATACTCTCCTGG - Intronic
1067952091 10:50750185-50750207 TCCCCAGGTGTATACTCTCCTGG + Intronic
1069139885 10:64810045-64810067 TCCCCAGGTTCTTTGTCCCAGGG + Intergenic
1069815833 10:71193743-71193765 TCCCCAGCTTTGTGCTCCCCTGG - Intergenic
1070834638 10:79440529-79440551 TCCCCAGATTTGCTCTCCCCTGG - Intronic
1072211675 10:93252244-93252266 TCCCCTGGAATTCTCTTCCCAGG + Intergenic
1074103942 10:110375089-110375111 TCCCCAGGGAGCTTGTCCCCTGG + Intergenic
1076867822 10:133176741-133176763 TCCTCAGGTATTAGATCCCCTGG + Intronic
1078000627 11:7492110-7492132 TCCCCAGGATTTTTACCCCCTGG - Intronic
1078399833 11:11016127-11016149 TCCCTATGTACTTTGTCCCCAGG + Intergenic
1083303153 11:61749220-61749242 TCCCCAGGGATTTTCATCTCTGG - Intergenic
1086732779 11:90270673-90270695 TCCCCAGGTGCTTTGTCCCAGGG + Intergenic
1089248223 11:117137846-117137868 TCCTCAGGAATTTTCAGCCCCGG - Intergenic
1089258488 11:117206715-117206737 TCCTCAGGAATTTTCAGCCCCGG + Exonic
1089323157 11:117639950-117639972 TCCCCAGGAATGTTCTCTCATGG + Intronic
1090099130 11:123775348-123775370 TCACCATGCATTTCCTCCCCAGG - Intergenic
1092022805 12:5216255-5216277 TCCCCAGGTATTTCCCAACCAGG + Intergenic
1094027633 12:25975782-25975804 TCCCCAGGTATTATTTCTTCTGG - Intronic
1095716708 12:45354038-45354060 TCCCTACATTTTTTCTCCCCTGG - Intronic
1095737138 12:45569759-45569781 CCCTCAGGTTTTTTCACCCCAGG - Intergenic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1097339957 12:58426394-58426416 TCCCCAGGTGTTCTGTCCCAGGG - Intergenic
1097417138 12:59327256-59327278 TCCCCAGGTTGTTCCTCGCCAGG - Intergenic
1099030875 12:77524313-77524335 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1101203066 12:102456970-102456992 TCCACAGGTATTATCTCTCCTGG + Intronic
1104095012 12:125548948-125548970 TCCCAAGTTATTTTCTCACAGGG - Intronic
1105346866 13:19581275-19581297 TCACCAGTCATTTTCTTCCCAGG + Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1107479587 13:40774494-40774516 TCACCAGTCATTTTCTTCCCAGG + Intergenic
1107683230 13:42871455-42871477 TCCCCAGGTTGTTCCTCGCCAGG - Intergenic
1111212055 13:85092066-85092088 TCACCAGGTATTTTGTTCCTAGG - Intergenic
1114844932 14:26309442-26309464 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1118878707 14:69808178-69808200 TACCAAGTTATTTTCTCACCTGG + Intergenic
1120704040 14:87729047-87729069 TCCCCACGTGTTTTCTCCTGTGG - Intergenic
1121891182 14:97592665-97592687 TCTTCAGTTATTTCCTCCCCTGG + Intergenic
1122899754 14:104777553-104777575 GCCCCAGGTATGTGTTCCCCAGG - Intronic
1127131549 15:55869807-55869829 TCCCTAGATATCTTCTGCCCTGG - Intronic
1127547119 15:60002171-60002193 TCCCCAGCTCCTTCCTCCCCAGG + Intergenic
1127629648 15:60815032-60815054 CCCCCAGGTTTTTTTTCCCACGG + Intronic
1128761884 15:70222564-70222586 GCGCTAGGTTTTTTCTCCCCTGG + Intergenic
1128914967 15:71551642-71551664 TCCCGAGGTTTTTTTTTCCCAGG + Intronic
1129198203 15:73983461-73983483 TCCCCAGGTAACTTCGCCACAGG + Exonic
1129432362 15:75509027-75509049 TCCTCATGTGTTTTCTCCACAGG - Exonic
1130058898 15:80555429-80555451 ATCCCAGTTATTCTCTCCCCTGG - Intronic
1130178127 15:81596157-81596179 GCTCCAGGGATTTTCTCCCCTGG - Intergenic
1131536116 15:93239449-93239471 TTCACAGGTATTGTGTCCCCAGG - Intergenic
1133571876 16:7049110-7049132 TCCCAAATTATTTTCTCTCCGGG + Intronic
1134453245 16:14376213-14376235 TTCCCACTTTTTTTCTCCCCTGG + Intergenic
1140528570 16:75644800-75644822 TGGCCAGGTATTTCCTCTCCAGG - Intronic
1141157644 16:81608559-81608581 CCCCCAGGAATTCACTCCCCCGG + Intronic
1142411993 16:89921599-89921621 TCCCCAGGTACTCACTCCCAGGG - Intronic
1143179214 17:4973796-4973818 GACCCAGGTATCTACTCCCCTGG + Intronic
1144196708 17:12901673-12901695 TCACCCTGCATTTTCTCCCCAGG - Intronic
1147182185 17:38693375-38693397 TCCCCCATCATTTTCTCCCCTGG - Intergenic
1147374374 17:40015368-40015390 GCCCCAGGTAATTTCCTCCCAGG + Intronic
1147779376 17:42929238-42929260 TTCCCAGGTAAGTTCTCCCCAGG + Intergenic
1149183790 17:53973251-53973273 TCCCCAGGTTACTTCACCCCTGG - Intergenic
1151159469 17:72152774-72152796 TCCTCAAGGATTTTCTCCCTGGG - Intergenic
1151581442 17:74981554-74981576 TCCCCAGGTCTCTTCTCCCAAGG + Intergenic
1154086665 18:11312275-11312297 ACCCCAGTTATTTGCACCCCTGG - Intergenic
1158853422 18:61518149-61518171 CCCCCAGGTGTTTTTTCCCAGGG - Intronic
1158929861 18:62313583-62313605 TCCACTGTTACTTTCTCCCCAGG - Intergenic
1159385925 18:67725644-67725666 TCCCCAGGTGTTCTGTCCCAGGG + Intergenic
1162042483 19:7979140-7979162 GCCCTAAGTAATTTCTCCCCAGG - Intronic
1163080020 19:14932335-14932357 TCCCTAGGTCCTTTCTTCCCTGG - Intergenic
1166353919 19:42216059-42216081 CTCCCTGGGATTTTCTCCCCTGG + Intronic
1167040708 19:47021118-47021140 TCCCCTGGGACTTTCTACCCGGG + Exonic
1167785922 19:51636284-51636306 TCCAAAGGTCTTTTCTCCCCAGG + Intronic
925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG + Intergenic
926133582 2:10320661-10320683 TCCCCAGGGATTCTCTCTCCAGG - Intronic
926771996 2:16386592-16386614 TCCCCAACTCTTTACTCCCCTGG - Intergenic
927117206 2:19916756-19916778 TCCCCAGGTGCTTTGTCCCAGGG - Intronic
927174739 2:20397880-20397902 TCCTCTGCCATTTTCTCCCCCGG - Intergenic
930889318 2:56364644-56364666 TCCCCCGGTATTTTCTATGCTGG + Intronic
931696002 2:64871029-64871051 TTCCCAGTTATTTTCCTCCCAGG - Intergenic
933657716 2:84903441-84903463 TCCACAGGTATCTTATCCTCTGG - Intronic
934126961 2:88904170-88904192 TCCTCAGGTGTCTTCTACCCAGG + Intergenic
934158297 2:89223653-89223675 TCCCCAGATGTTTTCTCTCCAGG - Intergenic
934208969 2:89958771-89958793 TCCCCAGATGTTTTCTCTCCAGG + Intergenic
935283467 2:101540674-101540696 TCCCCAGGGCTTTTCCCTCCTGG + Intergenic
937863618 2:126732004-126732026 AACCCAAGTATTGTCTCCCCTGG + Intergenic
938115899 2:128602791-128602813 TCCACAGGTACTGCCTCCCCAGG + Intergenic
939254757 2:139728412-139728434 TCCCCAAGTTTTTTGTCACCAGG - Intergenic
939609213 2:144289583-144289605 TAAACAGCTATTTTCTCCCCCGG - Intronic
941871321 2:170388945-170388967 TCCCCTGCTTTTGTCTCCCCAGG + Intronic
942639229 2:178043275-178043297 TCCCCAGGAAATTTCTCCACTGG + Intronic
943408717 2:187519757-187519779 TCCCCAGGTGTTCTGTCCCAGGG + Intronic
944267947 2:197748764-197748786 CCCCCAGGTGTTTTGTCCCAGGG - Intronic
945556368 2:211281372-211281394 TCACCAAATATTTTTTCCCCAGG - Intergenic
946353707 2:219171975-219171997 CTCCCAGGTATTCTCTTCCCAGG - Intronic
946477588 2:220023509-220023531 TGCCCAGGCATTTTCTTCTCTGG + Intergenic
947165509 2:227257772-227257794 TGACCAGCTATTTTCTGCCCTGG - Intronic
1169661804 20:7986722-7986744 TCCCCAGGTATTTTCTCCCCAGG - Intronic
1171197626 20:23212684-23212706 GCCCCAGGCATTTGTTCCCCAGG - Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1171967651 20:31542577-31542599 GCACCAGGTATCTTCACCCCAGG + Intronic
1173647048 20:44639857-44639879 TCCCTTGATATTTTCTCCCTAGG - Intronic
1174448253 20:50604641-50604663 TCACCAGGTAGTATCTCTCCCGG + Exonic
1178021227 21:28410860-28410882 TCTCCATATATTTTCTGCCCTGG + Intergenic
1178263175 21:31118333-31118355 TTCCCAGGAATCTTCTCCCACGG + Intergenic
1178521538 21:33291617-33291639 TTCACAGGTGTTTTCTCTCCTGG - Intronic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1182891542 22:33822977-33822999 TCCCCAGGTAACTTATACCCTGG - Intronic
1182952449 22:34390425-34390447 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1183674254 22:39290917-39290939 TCCCCAGCTGTCTGCTCCCCTGG + Intergenic
1183814197 22:40285749-40285771 TCCCCAGTTTATTTCCCCCCAGG + Exonic
1184187179 22:42872571-42872593 GCCCCAGGTATTAGCTCCGCAGG - Intronic
1184342872 22:43895704-43895726 TGCCCCGGCATTTTCTCCCCAGG + Intergenic
1184362270 22:44025505-44025527 TCCCCAGACATTTTCTCCCAGGG + Intronic
1184379858 22:44138470-44138492 GCCCCAGGTAGGTTCTCCTCAGG + Intronic
1184987874 22:48147712-48147734 TCCCCCTGTATTTCCTCCCAGGG - Intergenic
1185129737 22:49032219-49032241 GCCCCAGGCATCTTCTCCCATGG - Intergenic
949574426 3:5325064-5325086 TTCCCAGGCATTTTCTACCGAGG - Intergenic
951658004 3:25030939-25030961 TCCCCAGGTATTTACTCTGGAGG + Intergenic
954111321 3:48434977-48434999 TCCTCAGGTCTTTTCTCTCCGGG + Exonic
954512137 3:51134725-51134747 TTCCCAGGTATATTTTCCCATGG + Intronic
956337346 3:68178640-68178662 TGCCAAGGTATTTCCGCCCCAGG - Intronic
956389041 3:68752201-68752223 ACCCCATGTATTTGTTCCCCTGG + Intronic
957811548 3:85228933-85228955 TCCCCAGGTACTCTGTCCCAGGG + Intronic
961012095 3:123443252-123443274 GCCCCAGGTACTTACTTCCCTGG + Intronic
961145500 3:124589623-124589645 GCCCCAAGGATTTTATCCCCTGG - Intronic
962469242 3:135690608-135690630 ACCCCAGCTTTTATCTCCCCAGG - Intergenic
963852372 3:150221502-150221524 TCCCCGGATTTGTTCTCCCCAGG - Intergenic
964434685 3:156639168-156639190 TCCCAAAGTATTTTCTTCTCTGG + Intergenic
966503142 3:180668569-180668591 TTCCCAGTTATTTTCTCTCATGG + Intronic
967325727 3:188237268-188237290 TCCTCAGTTATTTCCTCCACTGG + Intronic
968420249 4:477943-477965 TCCCCACTTAGTTTCTGCCCAGG - Intronic
973219322 4:47707741-47707763 TACCCAGGTATATTCTCACCAGG - Intronic
975096678 4:70464777-70464799 TCCCCAGGTGCTTTGTCCCAGGG - Intronic
976167651 4:82272300-82272322 TCCCCAGGTGCTCTGTCCCCAGG - Intergenic
977792979 4:101129276-101129298 TCCCCAGGTGTTCTGTCCCAGGG - Intronic
979316524 4:119271484-119271506 TTGCCAGTTATTTTCTCTCCTGG - Exonic
979436465 4:120698480-120698502 TCACTAGGTATTTTCTCCTCTGG + Intronic
980442332 4:132865654-132865676 ACCCCAGGTATTTTCTACTGTGG + Intergenic
980881661 4:138716700-138716722 TCCCCAAGTCTATTTTCCCCTGG + Intergenic
981817245 4:148844862-148844884 GCCCAAAGTACTTTCTCCCCGGG - Intergenic
984101572 4:175493231-175493253 TCATCAGGCAGTTTCTCCCCAGG + Intergenic
984278920 4:177643741-177643763 TACCCAGGTCTATTTTCCCCTGG + Intergenic
986978975 5:13424283-13424305 TTCCAAGGCATTTTCTCTCCTGG - Intergenic
992689446 5:79228654-79228676 TGCCCAGCTATTTTGCCCCCAGG - Intronic
993201023 5:84815167-84815189 TTCCCACGTAATTTCTTCCCTGG - Intergenic
996870714 5:128190209-128190231 AGCCCAGGTCTTTTATCCCCAGG + Intergenic
998203123 5:140141098-140141120 TACCCTGGTATCTTATCCCCTGG - Intergenic
998265184 5:140662749-140662771 TCCCCAGGAAATCTTTCCCCAGG - Intergenic
1000191922 5:158919332-158919354 TCTCCGGGGATTTTCTCCTCTGG - Intronic
1001217411 5:169868819-169868841 TCTCCCGGTCTTTTCTACCCAGG - Intronic
1002422155 5:179154395-179154417 CCCCCAGGTATCCTGTCCCCAGG + Intronic
1002898554 6:1392878-1392900 GCCCGAGCTATTGTCTCCCCCGG - Intronic
1009719997 6:67456367-67456389 TCCCCAGGAATTTTTGCTCCAGG - Intergenic
1009826578 6:68873436-68873458 GCCCCAGTTATTTCTTCCCCAGG - Intronic
1011181244 6:84623603-84623625 TACCCAGGCACTATCTCCCCAGG + Intergenic
1011729467 6:90245879-90245901 TCTCCAGGAATTTTCTCCAAAGG + Intronic
1012756241 6:103234904-103234926 TCCCAAGGTGTTTACTCCCTAGG - Intergenic
1014387027 6:120815805-120815827 TCCCCAGGTGTTCTGTCCCAGGG + Intergenic
1016691491 6:146943219-146943241 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1016842404 6:148537685-148537707 TCCCAAGGTAACTGCTCCCCAGG + Intronic
1017988165 6:159462833-159462855 TCCCAAATTATTTTCTCCCAGGG - Intergenic
1019436052 7:1022764-1022786 TCCCCAGTTACTTCCTCCCTAGG + Intronic
1021710209 7:23408907-23408929 TCCCCAACTATTTTCGCACCAGG + Intronic
1024697533 7:51871685-51871707 TCCCCAGGTTGTTCCTCGCCAGG + Intergenic
1026457143 7:70582539-70582561 ACCACAGGTATTTTCCCCTCTGG + Intronic
1026791266 7:73333600-73333622 GCCCCAGGGAGATTCTCCCCTGG - Intronic
1026932819 7:74233924-74233946 TTCCCAGGCAATTTCACCCCTGG + Intronic
1028344535 7:89763175-89763197 TCCCCAGGTAATTTGGCTCCAGG + Intergenic
1028415345 7:90574563-90574585 TGCCCAGTTATTTTCTCACAAGG - Intronic
1029620748 7:101688567-101688589 TCCCCAGGTCCTCACTCCCCGGG + Intergenic
1029850532 7:103457113-103457135 TCCCCAGGTACTCTGTCCCAGGG + Intergenic
1032899826 7:136294730-136294752 TCCCCAAGTATTTTCAATCCAGG - Intergenic
1034888737 7:154820237-154820259 TCTCCAGGGATTTCCTTCCCAGG - Intronic
1035086134 7:156259993-156260015 TCCCCAGGTTCTTTCTGGCCTGG - Intergenic
1035213788 7:157349448-157349470 TCCCCTGGTCTTTTCTAACCTGG - Intronic
1035655785 8:1303720-1303742 CTCCCAGGCATTTTCTCCTCTGG + Intergenic
1035941790 8:3909534-3909556 TCCCCAGGTATTTCAACCCTAGG + Intronic
1036551242 8:9816483-9816505 TCCCCAGGTGCTTTGTCCCAGGG - Intergenic
1037643758 8:20771756-20771778 TCCCCAGATATGTTTTCCACAGG - Intergenic
1039362434 8:36892839-36892861 ACCTCAGGTTTTTTTTCCCCTGG + Intronic
1040590117 8:48783861-48783883 TCCCCAGGTTTTTCCCCTCCGGG - Intergenic
1040704544 8:50109965-50109987 TCCCCATCTAGTTTCTGCCCAGG + Intronic
1041383130 8:57273067-57273089 TCCCCAGGTGTTCTGTCCCAGGG + Intergenic
1043868232 8:85399948-85399970 GCCCCAGTGTTTTTCTCCCCGGG - Intronic
1046771080 8:118117067-118117089 TCCAGAGGTACTTTTTCCCCAGG + Intergenic
1048703171 8:137117782-137117804 TTCCCAGCTATTTTCTTCTCTGG + Intergenic
1049646534 8:143738257-143738279 TCACCAGGTGTCTGCTCCCCAGG + Intergenic
1051047132 9:12888548-12888570 ACCCCAGGTATTGTCTTCCTAGG - Intergenic
1053426473 9:38013619-38013641 TCCTCAGGTAATTTCTAGCCAGG + Intronic
1053614224 9:39746559-39746581 TCTCCAGACATTTTCTTCCCTGG - Intergenic
1053872254 9:42504500-42504522 TCTCCAGACATTTTCTTCCCTGG - Intergenic
1053900503 9:42791434-42791456 TCTCCAGACATTTTCTTCCCTGG + Intergenic
1054239292 9:62595833-62595855 TCTCCAGACATTTTCTTCCCTGG + Intergenic
1054261143 9:62866183-62866205 TCTCCAGACATTTTCTTCCCTGG - Intergenic
1054553423 9:66630355-66630377 TCTCCAGACATTTTCTTCCCTGG + Intergenic
1055177075 9:73333191-73333213 TCCCCAAATATTTTCTTCTCTGG + Intergenic
1055624403 9:78160064-78160086 TGCCTAGGTTTTTTCTCTCCTGG - Intergenic
1055934162 9:81589501-81589523 CCAACAGGTATTTACTCCCCAGG + Intronic
1058265832 9:102897947-102897969 TCCCCAGGTGCTCTCTCCCAGGG - Intergenic
1058344287 9:103941512-103941534 TCCCCAGCTTTTTTCGCACCAGG - Intergenic
1061373854 9:130212748-130212770 TGCCCAAGAATTTTGTCCCCAGG - Intronic
1061956409 9:133963722-133963744 TTCACAGGCATTTTTTCCCCTGG - Intronic
1188776387 X:34224928-34224950 TCCGCAGGTATTTTTCCCACTGG + Intergenic
1189069842 X:37851703-37851725 TCCTCAGGAGTTTTCTCCTCAGG + Intronic
1193404513 X:81084433-81084455 TCCCCAGGTACTCTGTCCCAGGG - Intergenic
1194258729 X:91668178-91668200 TCTCCAGGTATTTTCTCCTATGG + Intergenic
1198072204 X:133159882-133159904 TCCCCAGGTGCTTTGTCCCAGGG - Intergenic
1200407653 Y:2829807-2829829 CCCCCAGGTATTCTGTCCCAGGG - Intergenic
1200577490 Y:4907688-4907710 TCTCCAGGTATTTTCTCCTATGG + Intergenic
1201312861 Y:12612554-12612576 TCCCCAGGTGTTCTGTCCCCAGG - Intergenic
1201422249 Y:13812319-13812341 TCCCCAGGTACTCTTTCCCAGGG + Intergenic
1201462309 Y:14239827-14239849 CCCCCAGGTACTCTGTCCCCAGG - Intergenic