ID: 1169664522

View in Genome Browser
Species Human (GRCh38)
Location 20:8019500-8019522
Sequence CGCTGCCGCCGGAGCAGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169664522_1169664526 -10 Left 1169664522 20:8019500-8019522 CCGGCTCTGCTCCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 14
4: 177
Right 1169664526 20:8019513-8019535 GGCGGCAGCGCGGCCTCCTCGGG 0: 1
1: 0
2: 2
3: 21
4: 218
1169664522_1169664536 30 Left 1169664522 20:8019500-8019522 CCGGCTCTGCTCCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 14
4: 177
Right 1169664536 20:8019553-8019575 CAGCCGCGATCCAGGCGGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
1169664522_1169664534 25 Left 1169664522 20:8019500-8019522 CCGGCTCTGCTCCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 14
4: 177
Right 1169664534 20:8019548-8019570 CGCCACAGCCGCGATCCAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 65
1169664522_1169664532 22 Left 1169664522 20:8019500-8019522 CCGGCTCTGCTCCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 14
4: 177
Right 1169664532 20:8019545-8019567 CGCCGCCACAGCCGCGATCCAGG 0: 1
1: 0
2: 1
3: 13
4: 115
1169664522_1169664527 -9 Left 1169664522 20:8019500-8019522 CCGGCTCTGCTCCGGCGGCAGCG 0: 1
1: 0
2: 3
3: 14
4: 177
Right 1169664527 20:8019514-8019536 GCGGCAGCGCGGCCTCCTCGGGG 0: 1
1: 0
2: 4
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169664522 Original CRISPR CGCTGCCGCCGGAGCAGAGC CGG (reversed) Exonic
900091919 1:924387-924409 TGCTGCCGCCGGCGGAGAGCGGG + Intergenic
900195759 1:1374805-1374827 CGCTGCCGCCTGACCTGAACGGG - Exonic
900206870 1:1435382-1435404 CCCAGCCGCGGGAGCCGAGCAGG - Intronic
900949602 1:5850942-5850964 CCTTGTCGCAGGAGCAGAGCTGG + Intergenic
901155833 1:7137619-7137641 AGCTTCAGCTGGAGCAGAGCAGG - Intronic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
902501429 1:16914093-16914115 CGCTGCTGCCGAGGCCGAGCGGG - Intronic
903883802 1:26529880-26529902 CGGGGCCGCCGGAGGAGCGCGGG + Intronic
904054327 1:27660090-27660112 CGCAGCCGTCGGAGTAGAGATGG - Intergenic
904618617 1:31762929-31762951 CGCCGCGGCCCGTGCAGAGCAGG - Intronic
906640476 1:47438084-47438106 AGCCGCTGCCGGAGCGGAGCCGG + Exonic
909931438 1:81503628-81503650 CCCTGCCCCCGGAGTACAGCAGG - Intronic
913178569 1:116297926-116297948 AGCTGACTCCGGAGCATAGCTGG + Intergenic
920912720 1:210233169-210233191 CGCAGCGGCCGGAGCGGAGTCGG + Intronic
921390433 1:214608774-214608796 CGATGCGGCCGGGGCAGGGCGGG + Intronic
921599281 1:217089715-217089737 CGCGCCCGCGGGGGCAGAGCGGG - Intronic
922003633 1:221505226-221505248 TGCTGCCCCTGGGGCAGAGCAGG + Intergenic
922513138 1:226186439-226186461 CGCGGCGGCTGGAGCAGCGCTGG - Exonic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1069740631 10:70685009-70685031 CGGCTCCTCCGGAGCAGAGCCGG + Intronic
1070162441 10:73874303-73874325 CGCAGCGGCCGGTGCAGGGCCGG + Intronic
1072915527 10:99535460-99535482 CGCCGCCGCCGCAGCAGCGGCGG + Exonic
1073099224 10:100998268-100998290 AGCTGCCGCCTGAGCTGGGCAGG + Intronic
1073572138 10:104589554-104589576 GGCGGCAGCAGGAGCAGAGCTGG + Intergenic
1076306126 10:129466945-129466967 CGCTGCCGGAGGACCAGGGCCGG + Intergenic
1076671407 10:132122728-132122750 CGCTGCTGCCAGGGCAGGGCTGG + Intronic
1076999613 11:316055-316077 GGCACCCGCGGGAGCAGAGCTGG + Intergenic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1080385813 11:31810571-31810593 CGCTGGCGCTGGGGCTGAGCTGG + Intronic
1080457319 11:32428991-32429013 CTCTTCCGCAGGAGCAGCGCGGG + Intronic
1083436634 11:62647592-62647614 CGATGCAGCTGGTGCAGAGCTGG - Exonic
1084504431 11:69556361-69556383 GGCTGCTGAGGGAGCAGAGCCGG - Intergenic
1088764356 11:112961927-112961949 CGCGGCGGTGGGAGCAGAGCCGG + Intronic
1089124761 11:116169088-116169110 GGCTGCAGCAGGAGCAGAGCTGG - Intergenic
1090619626 11:128549349-128549371 TGCCGCGGCCGGAGCCGAGCGGG + Intronic
1093233129 12:16573669-16573691 CGCTCCAGCTCGAGCAGAGCAGG - Intronic
1093464893 12:19439582-19439604 CGCCGACGCCGCTGCAGAGCAGG - Intronic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1104602633 12:130163438-130163460 CGCTGCGGCCGGAACAGCGGCGG - Exonic
1105472027 13:20703594-20703616 CGCTGGCGGCGGAGCAGGGATGG + Intronic
1106705566 13:32275532-32275554 CGATGCAGACGGAGCAGAGGTGG - Intronic
1106833488 13:33610505-33610527 CGCAGGCGCAGGAGCAGCGCGGG - Intergenic
1107800594 13:44104675-44104697 AGAAGTCGCCGGAGCAGAGCAGG + Intergenic
1113375748 13:109764275-109764297 CGCTGTCGCCACACCAGAGCCGG + Intronic
1118388816 14:65279752-65279774 GGCTGCCGCCGGGGCAGTCCAGG - Intergenic
1121422966 14:93828562-93828584 CAATGCAGCCGGGGCAGAGCTGG + Intergenic
1122772638 14:104104169-104104191 CACTGTCCCGGGAGCAGAGCAGG + Intronic
1122860324 14:104579623-104579645 CGCTGGCCCCGGAGCAGAAGGGG - Intronic
1123180074 14:106461058-106461080 AGTGGCCGCCGGAGCAGTGCCGG - Intergenic
1123480685 15:20628737-20628759 CGCCGCCGCCCGAGGAGAACGGG - Intergenic
1123637324 15:22371630-22371652 CGCCGCCGCCCGAGGAGAACGGG + Intergenic
1129893794 15:79089539-79089561 CGCTGCCTCCGCAGCAGCCCTGG + Intronic
1130335244 15:82952538-82952560 AGCGGCCGCCGGAGCAGCGCCGG - Exonic
1130990100 15:88871080-88871102 CTCTGCCGGCCCAGCAGAGCAGG + Intronic
1131375011 15:91916133-91916155 CGATGCCGCCGCAGCCGATCAGG - Exonic
1132495659 16:262101-262123 CGGTGCTGCCGGAGTAGAGGTGG - Exonic
1132722036 16:1321224-1321246 CGCTGCAGGCGGAGCAGTGGGGG - Intronic
1134492204 16:14703597-14703619 CGCGGCGGCCGGAGCAGGGTGGG - Intergenic
1134497585 16:14742719-14742741 CGCGGCGGCCGGAGCAGGGTGGG - Intronic
1135135813 16:19884891-19884913 CGCGGCCGCTGCAGCAGCGCGGG - Exonic
1136025217 16:27464413-27464435 CGCTGCAGCGGGAGCAGCACAGG - Exonic
1137768759 16:50997714-50997736 CGCTGGCTACGGAGCAGGGCTGG - Intergenic
1138122489 16:54411767-54411789 CGGTGCCGTGGGAGCAGAGTTGG - Intergenic
1138251032 16:55502070-55502092 TGCTGCCGCCGGAACTGAGGTGG + Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1139966125 16:70746403-70746425 CGCAGCCGCTGGCACAGAGCAGG - Intronic
1141570685 16:84931876-84931898 CGCTGCCGCTGGAGAAGCTCCGG + Intergenic
1142169029 16:88610750-88610772 CCCTGCCTCTGGAGCAGAGCAGG - Intronic
1145190703 17:20841091-20841113 CGATGCGGCCGGGGCAGGGCGGG - Intronic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1147183649 17:38702356-38702378 GGCCGCCGCCGGAGCCGAGCGGG - Intergenic
1147214987 17:38893807-38893829 GGCTGCCGTGGGGGCAGAGCTGG + Intronic
1147258391 17:39195394-39195416 CCCCTCCGCAGGAGCAGAGCAGG + Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1151586629 17:75012708-75012730 CGCTGGGGCCTGAGCCGAGCCGG + Exonic
1152299521 17:79486887-79486909 TGCTGCCTCGGGAGCAGTGCTGG - Intronic
1152870722 17:82751789-82751811 GGCCGCCGCCGGAGGACAGCGGG - Intergenic
1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160966413 19:1748814-1748836 CGCGGCCCCCGCAGCTGAGCGGG - Intergenic
1160995804 19:1881500-1881522 CGATGCGGCCGGGGCAGGGCGGG + Exonic
1161068916 19:2250923-2250945 CGCGGCAGCAGGAGCAGGGCCGG - Exonic
1161140318 19:2643333-2643355 CGGTGCCGACGGAGCCGGGCCGG - Intronic
1161140344 19:2643460-2643482 CGGTGCCGACGGAGCCGGGCCGG - Intronic
1161140370 19:2643587-2643609 CGGTGCCGACGGAGCCGGGCCGG - Intronic
1161849759 19:6732230-6732252 AGCAGCCTCCGGAGCAGGGCGGG - Intronic
1162099998 19:8333748-8333770 CGCTGCAGCGGCAGCTGAGCCGG - Exonic
1164709412 19:30344647-30344669 CGCTTGGGCTGGAGCAGAGCAGG + Intronic
1164855740 19:31519305-31519327 CACAGCCGTCTGAGCAGAGCAGG + Intergenic
1165553184 19:36605602-36605624 CGCTTCCGCGGGATCAGAACGGG - Intronic
1166092609 19:40519968-40519990 GGCCGCCGACGGCGCAGAGCTGG + Exonic
1166543287 19:43619578-43619600 TGCAGCCGCCGCCGCAGAGCCGG - Exonic
1166790616 19:45396572-45396594 CGCTGCCGCCGGAGCCTAGCAGG + Exonic
1168584115 19:57578815-57578837 CGCTGCCTCCGGCACAGAGCGGG - Exonic
925404542 2:3597367-3597389 CGCTGACCCCGGAGCAGCCCAGG - Intronic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
926101862 2:10122978-10123000 CGCAGCCGCCGGCCCTGAGCGGG + Exonic
927558043 2:24049778-24049800 GGCTGGGGCCGGAGCCGAGCCGG + Exonic
929124508 2:38511029-38511051 CACTGTCCCCAGAGCAGAGCAGG + Intergenic
929188791 2:39120994-39121016 CGCCGCCGCCGGTGTAGCGCTGG + Exonic
933807775 2:86012456-86012478 GGCTGCAGCAGGACCAGAGCAGG + Intergenic
936279154 2:111122666-111122688 GGCTGCGGCCGGGGCAGCGCGGG + Intronic
936976121 2:118224257-118224279 CGTGGGCGCCTGAGCAGAGCCGG + Intergenic
937859861 2:126699129-126699151 AGCTGCCCAGGGAGCAGAGCAGG + Intergenic
938305508 2:130251880-130251902 CGCTGCAGCCGGTGCAGTCCTGG + Intergenic
940265158 2:151828450-151828472 CGCAGCCGCCCGAGAGGAGCTGG - Exonic
942565824 2:177264365-177264387 CGCTTGCGCCGGGGCAGGGCGGG - Intronic
948280455 2:236743301-236743323 CACTGCTGACGGAGCACAGCTGG + Intergenic
948469533 2:238168142-238168164 CACTGCCACAGGAGCACAGCAGG - Intronic
948501416 2:238397661-238397683 CCCTGCAGCAGGAGCAGAGGTGG + Exonic
948501432 2:238397705-238397727 CCCTGCAGCAGGAGCAGAGGTGG + Intronic
948501448 2:238397749-238397771 CCCTGCAGCAGGAGCAGAGGTGG + Intronic
948501492 2:238397881-238397903 CCCTGCAGCAGGAGCAGAGGTGG + Intronic
948610548 2:239163698-239163720 CCCTGCCTCCGGTGAAGAGCTGG + Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1170969736 20:21105453-21105475 TGCAGCCCCCGGAGCAGACCTGG + Intergenic
1171344860 20:24458527-24458549 CACTGCCCCAGGAGCAGAGAAGG + Intergenic
1175171251 20:57082803-57082825 CGCTGTGGCTGGAACAGAGCAGG + Intergenic
1177431711 21:20998307-20998329 CGCCGCGGCGGCAGCAGAGCCGG - Exonic
1177905253 21:26966136-26966158 TGCCGCCGCCGGAGTAGAGTTGG + Exonic
1178702010 21:34841611-34841633 CACTGCTGCCGGAGCAAAGAGGG - Intronic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1180046884 21:45310673-45310695 CTCTGCCTCCAGAGCAGACCGGG - Intergenic
1180188822 21:46153202-46153224 TGCTGCCGCTGGGGCAGGGCTGG - Intronic
1181121584 22:20670918-20670940 CGATGCGGCCGGGGCAGGGCGGG + Intergenic
1181334545 22:22117942-22117964 CGATGCGGCCGGGGCAGGGCGGG + Intergenic
1184130241 22:42513127-42513149 CCCTGCCCCCACAGCAGAGCTGG - Intronic
1184140417 22:42574950-42574972 CCCTGCCCCCACAGCAGAGCTGG - Intergenic
1185292479 22:50034176-50034198 CTCAGGCGCTGGAGCAGAGCTGG - Intronic
950509878 3:13419834-13419856 CGCTGAGGCGCGAGCAGAGCGGG - Intronic
953784167 3:45897827-45897849 AGCTGCAGCAGGAGGAGAGCAGG + Intronic
954202104 3:49029506-49029528 CGCTGCGGCGGGGGCGGAGCTGG + Intergenic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
956675004 3:71725230-71725252 CGCTGCAGCCTGAGCCGGGCGGG - Exonic
960137744 3:114122831-114122853 AGCTGCCACTTGAGCAGAGCAGG + Intergenic
960518324 3:118626588-118626610 CCCTCATGCCGGAGCAGAGCAGG - Intergenic
961176892 3:124842995-124843017 CGCTGCCGCCGGCCCCGAGAGGG - Intronic
962381776 3:134903989-134904011 AGCTGCCCAGGGAGCAGAGCAGG + Intronic
966306514 3:178541932-178541954 GGCTGGAGTCGGAGCAGAGCAGG - Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968274470 3:197429438-197429460 CTCTGCTGCCAGAACAGAGCGGG - Intergenic
968458956 4:714266-714288 CGCAGCCGCCTGAACAGACCAGG + Intronic
968733786 4:2284811-2284833 CGCTGTGGCCTGAGCTGAGCTGG - Intronic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
968765843 4:2468768-2468790 AGCTGCCTCCGGAGCCGAGCAGG - Intronic
969263660 4:6050119-6050141 CGCTGTCCCTGGAGCTGAGCAGG + Intronic
975615789 4:76245581-76245603 TGCTGACGCCAGGGCAGAGCAGG + Intronic
980013604 4:127623302-127623324 CGCGGCGGCCGGAGCTGTGCGGG + Intronic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
985683709 5:1270907-1270929 TGCGGCAGCCGGAGCGGAGCAGG - Intronic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992528076 5:77630558-77630580 CTCTGCCGCCGGCGCTGGGCAGG - Exonic
998134664 5:139668384-139668406 CGCGGCCGCCAGAGCCGCGCAGG - Intronic
999255580 5:150208404-150208426 TGCTGCGGCTGGAGCAGAGGGGG + Intronic
1000220462 5:159209312-159209334 CGCCGCCGCCCGAGGAGAACGGG - Intronic
1002317971 5:178356680-178356702 CATTGCCGCCGGAGCAGAGCCGG + Intronic
1005881034 6:30061250-30061272 CCCCGCCGCGGGCGCAGAGCTGG + Exonic
1006642874 6:35497540-35497562 CGCAGCCGCCAGGGCGGAGCCGG - Intergenic
1008649065 6:53544942-53544964 CGCCGCCGCCGCATCGGAGCGGG - Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1010244783 6:73653471-73653493 CGGTGCAGCCGGCGCTGAGCTGG - Intronic
1016590113 6:145735160-145735182 GCCTGCCCCCGGCGCAGAGCGGG - Intronic
1017798258 6:157867328-157867350 CCCTGCCTCCGGAACAGAACAGG + Intronic
1017972953 6:159329060-159329082 CACTGCCACCGAAGCAGCGCAGG - Intergenic
1018738363 6:166707262-166707284 CGCAGCCCGCAGAGCAGAGCCGG + Intronic
1019032610 6:169025381-169025403 CGCTGCGGGCAGAGCAGAGGGGG - Intergenic
1019286987 7:228573-228595 CGCTGCCCTCAGAGGAGAGCTGG - Exonic
1019559411 7:1648481-1648503 GGCTGCCTGCGGAGCGGAGCCGG + Intergenic
1019636287 7:2077764-2077786 GGGTGCTTCCGGAGCAGAGCAGG - Intronic
1020137016 7:5593260-5593282 CGGTGCCGCCGAAGTAGCGCCGG - Exonic
1020796867 7:12687081-12687103 CCCTGCCGAGGGAGAAGAGCCGG + Intronic
1021116780 7:16753755-16753777 TGCGGCCGCCGCAGCTGAGCCGG - Exonic
1029339252 7:99929576-99929598 GGCTGCTGGCGGAGGAGAGCCGG - Exonic
1029347940 7:99992422-99992444 GGCTGCTGGCGGAGGAGAGCTGG + Intergenic
1029540671 7:101180305-101180327 AGCTGCCGCCGGAGCGTCGCCGG - Intergenic
1032391216 7:131556523-131556545 CCCTGCCGCTGCAGCAGAGCCGG + Exonic
1034988597 7:155533499-155533521 CGCTCCGGCCCGCGCAGAGCGGG + Intronic
1038883439 8:31639373-31639395 TGCTGCTGCCGGAGCGGAGCGGG - Intronic
1039474630 8:37833233-37833255 CTGTGCCCCCGAAGCAGAGCTGG - Intronic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1041691638 8:60693427-60693449 CCCTGCCAGAGGAGCAGAGCTGG - Intronic
1043033556 8:75169025-75169047 CTCTGCCTCTGCAGCAGAGCTGG + Intergenic
1044608700 8:94071059-94071081 CGGTGTCGCCAGATCAGAGCTGG + Intergenic
1044725922 8:95194143-95194165 GGCTGCCTCCAGAGCAGGGCAGG - Intergenic
1049409037 8:142464285-142464307 GGCGGCCGCCGGAGCAGACGCGG + Exonic
1049776763 8:144409522-144409544 CGCTGCGGGCGGAGCAGCGCGGG + Intergenic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1054785081 9:69202730-69202752 CTCTGCCGCCTGGGCACAGCAGG - Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1058467561 9:105244628-105244650 TGCTGCAGCAGGAGCAGAGCAGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062113376 9:134795018-134795040 AGCTGCCACCTGAGCAGGGCCGG + Intronic
1062176844 9:135168022-135168044 AGCTGCCACCGCAGCAGCGCTGG + Intergenic
1189308615 X:40005452-40005474 CGCTGCCGCCGGGAAAGTGCCGG + Intergenic