ID: 1169665316

View in Genome Browser
Species Human (GRCh38)
Location 20:8027857-8027879
Sequence TGTTCTCATCTGGAGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665316_1169665324 27 Left 1169665316 20:8027857-8027879 CCCCTGAGCTCCAGATGAGAACA No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data
1169665316_1169665321 -7 Left 1169665316 20:8027857-8027879 CCCCTGAGCTCCAGATGAGAACA No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665316 Original CRISPR TGTTCTCATCTGGAGCTCAG GGG (reversed) Intergenic