ID: 1169665317

View in Genome Browser
Species Human (GRCh38)
Location 20:8027858-8027880
Sequence GTGTTCTCATCTGGAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665317_1169665321 -8 Left 1169665317 20:8027858-8027880 CCCTGAGCTCCAGATGAGAACAC No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data
1169665317_1169665324 26 Left 1169665317 20:8027858-8027880 CCCTGAGCTCCAGATGAGAACAC No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665317 Original CRISPR GTGTTCTCATCTGGAGCTCA GGG (reversed) Intergenic