ID: 1169665318

View in Genome Browser
Species Human (GRCh38)
Location 20:8027859-8027881
Sequence GGTGTTCTCATCTGGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665318_1169665321 -9 Left 1169665318 20:8027859-8027881 CCTGAGCTCCAGATGAGAACACC No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data
1169665318_1169665324 25 Left 1169665318 20:8027859-8027881 CCTGAGCTCCAGATGAGAACACC No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665318 Original CRISPR GGTGTTCTCATCTGGAGCTC AGG (reversed) Intergenic