ID: 1169665321

View in Genome Browser
Species Human (GRCh38)
Location 20:8027873-8027895
Sequence GAGAACACCCAGGTCAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665314_1169665321 21 Left 1169665314 20:8027829-8027851 CCAACAACATGAATGAACTTGGA No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data
1169665317_1169665321 -8 Left 1169665317 20:8027858-8027880 CCCTGAGCTCCAGATGAGAACAC No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data
1169665318_1169665321 -9 Left 1169665318 20:8027859-8027881 CCTGAGCTCCAGATGAGAACACC No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data
1169665316_1169665321 -7 Left 1169665316 20:8027857-8027879 CCCCTGAGCTCCAGATGAGAACA No data
Right 1169665321 20:8027873-8027895 GAGAACACCCAGGTCAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665321 Original CRISPR GAGAACACCCAGGTCAACTC AGG Intergenic