ID: 1169665322

View in Genome Browser
Species Human (GRCh38)
Location 20:8027880-8027902
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665322_1169665324 4 Left 1169665322 20:8027880-8027902 CCCAGGTCAACTCAGGTCATGAG No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665322 Original CRISPR CTCATGACCTGAGTTGACCT GGG (reversed) Intergenic