ID: 1169665323

View in Genome Browser
Species Human (GRCh38)
Location 20:8027881-8027903
Sequence GCTCATGACCTGAGTTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665323_1169665324 3 Left 1169665323 20:8027881-8027903 CCAGGTCAACTCAGGTCATGAGC No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665323 Original CRISPR GCTCATGACCTGAGTTGACC TGG (reversed) Intergenic