ID: 1169665324

View in Genome Browser
Species Human (GRCh38)
Location 20:8027907-8027929
Sequence GAACCCTGTTATATTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169665323_1169665324 3 Left 1169665323 20:8027881-8027903 CCAGGTCAACTCAGGTCATGAGC No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data
1169665320_1169665324 17 Left 1169665320 20:8027867-8027889 CCAGATGAGAACACCCAGGTCAA No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data
1169665318_1169665324 25 Left 1169665318 20:8027859-8027881 CCTGAGCTCCAGATGAGAACACC No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data
1169665317_1169665324 26 Left 1169665317 20:8027858-8027880 CCCTGAGCTCCAGATGAGAACAC No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data
1169665316_1169665324 27 Left 1169665316 20:8027857-8027879 CCCCTGAGCTCCAGATGAGAACA No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data
1169665322_1169665324 4 Left 1169665322 20:8027880-8027902 CCCAGGTCAACTCAGGTCATGAG No data
Right 1169665324 20:8027907-8027929 GAACCCTGTTATATTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169665324 Original CRISPR GAACCCTGTTATATTCTCCT TGG Intergenic