ID: 1169666449

View in Genome Browser
Species Human (GRCh38)
Location 20:8041876-8041898
Sequence CTGTGGAAACAGCAGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169666449_1169666456 20 Left 1169666449 20:8041876-8041898 CCATGTCCCTGCTGTTTCCACAG No data
Right 1169666456 20:8041919-8041941 TCTCCTCAGGGTAGGAATTGTGG No data
1169666449_1169666453 7 Left 1169666449 20:8041876-8041898 CCATGTCCCTGCTGTTTCCACAG No data
Right 1169666453 20:8041906-8041928 GTGTTAGACAAGTTCTCCTCAGG No data
1169666449_1169666455 12 Left 1169666449 20:8041876-8041898 CCATGTCCCTGCTGTTTCCACAG No data
Right 1169666455 20:8041911-8041933 AGACAAGTTCTCCTCAGGGTAGG No data
1169666449_1169666454 8 Left 1169666449 20:8041876-8041898 CCATGTCCCTGCTGTTTCCACAG No data
Right 1169666454 20:8041907-8041929 TGTTAGACAAGTTCTCCTCAGGG No data
1169666449_1169666457 21 Left 1169666449 20:8041876-8041898 CCATGTCCCTGCTGTTTCCACAG No data
Right 1169666457 20:8041920-8041942 CTCCTCAGGGTAGGAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169666449 Original CRISPR CTGTGGAAACAGCAGGGACA TGG (reversed) Intergenic
No off target data available for this crispr