ID: 1169670818

View in Genome Browser
Species Human (GRCh38)
Location 20:8099804-8099826
Sequence CTTTGCAAGACAGTGTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169670818_1169670822 27 Left 1169670818 20:8099804-8099826 CCAGCTCACACTGTCTTGCAAAG No data
Right 1169670822 20:8099854-8099876 AGAATTCACTTACTTCAGGTTGG No data
1169670818_1169670821 23 Left 1169670818 20:8099804-8099826 CCAGCTCACACTGTCTTGCAAAG No data
Right 1169670821 20:8099850-8099872 ACTAAGAATTCACTTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169670818 Original CRISPR CTTTGCAAGACAGTGTGAGC TGG (reversed) Intergenic